eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| familial melanoma | ||||
| Disease ID | 604 |
|---|---|
| Disease | familial melanoma |
| Definition | A melanoma defined by the presence of multiple cases of cutaneous melanoma among blood-relatives on the same side of the family. It is caused by germline mutations in the CDKN2A or CDK4 genes. It is associated with an increased risk of pancreatic cancer in a subset of CDKN2A families (WHO, 2006). |
| Synonym | familial cutaneous melanoma hereditary cutaneous melanoma hereditary melanoma |
| Orphanet | |
| DOID | |
| UMLS | C1512419 |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:3) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:2) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:27) 434 | ASIP | 2.393 | DISEASES 8314 | BAP1 | 3.247 | DISEASES 675 | BRCA2 | 1.028 | DISEASES 1029 | CDKN2A | 6.521 | DISEASES 54898 | ELOVL2 | 2.221 | DISEASES 22862 | FNDC3A | 1.911 | DISEASES 3397 | ID1 | 1.911 | DISEASES 3447 | IFNA13 | 2.709 | DISEASES 3451 | IFNA17 | 3.246 | DISEASES 3440 | IFNA2 | 2.173 | DISEASES 3482 | IGF2R | 1.019 | DISEASES 55958 | KLHL9 | 2.087 | DISEASES 4157 | MC1R | 5.301 | DISEASES 4193 | MDM2 | 1.674 | DISEASES 4194 | MDM4 | 1.156 | DISEASES 4507 | MTAP | 1.448 | DISEASES 23054 | NCOA6 | 2.311 | DISEASES 2494 | NR5A2 | 1.501 | DISEASES 4893 | NRAS | 3.044 | DISEASES 4948 | OCA2 | 1.249 | DISEASES 8398 | PLA2G6 | 1.249 | DISEASES 25913 | POT1 | 3.484 | DISEASES 5514 | PPP1R10 | 2.334 | DISEASES 5789 | PTPRD | 1.651 | DISEASES 28984 | RGCC | 1.234 | DISEASES 6161 | RPL32 | 2.364 | DISEASES 7306 | TYRP1 | 2.41 | DISEASES |
| Locus | Symbol | Locus(Total Locus:12) |
| Disease ID | 604 |
|---|---|
| Disease | familial melanoma |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:11) HP:0006753 | Neoplasm of the stomach HP:0002071 | Abnormality of extrapyramidal motor function HP:0000958 | Dry skin HP:0002894 | Neoplasm of the pancreas HP:0001480 | Freckling HP:0000488 | Retinopathy HP:0100013 | Neoplasm of the breast HP:0100763 | Abnormality of the lymphatic system HP:0003764 | Nevus HP:0001595 | Abnormality of the hair HP:0002861 | Melanoma |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:3) |
| Disease ID | 604 |
|---|---|
| Disease | familial melanoma |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:17) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104894094 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21971058 | C | G,A |
| rs113488022 | 12794760 | 673 | BRAF | umls:C1512419 | BeFree | We therefore conclude that the common somatic BRAF mutation V599E does not contribute to polygenic and familial melanoma predisposition. | 0.000542884 | 2003 | BRAF | 7 | 140753336 | A | T,G,C |
| rs11547328 | 11726500 | 1019 | CDK4 | umls:C1512419 | BeFree | This mutation (replacement of Arg24 by Cys) was first found in patients with hereditary melanoma and renders Cdk4 insensitive to INK4 inhibitors. | 0.124885954 | 2001 | CDK4;MARCH9 | 12 | 57751648 | G | A |
| rs11547328 | NA | 1019 | CDK4 | umls:C1512419 | CLINVAR | NA | 0.124885954 | NA | CDK4;MARCH9 | 12 | 57751648 | G | A |
| rs137854599 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21971093 | C | T |
| rs1800586 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21974861 | C | G,A |
| rs199907548 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21974682 | A | G |
| rs2284063 | 19578365 | 1029 | CDKN2A | umls:C1512419 | BeFree | We identified strongly associated variants in MTAP, a gene adjacent to the familial melanoma susceptibility locus CDKN2A on 9p21 (rs4636294, combined P = 3.4 x 10(-15)), as well as in PLA2G6 on 22q13.1 (rs2284063, combined P = 3.4 x 10(-8)). | 0.145439591 | 2009 | PLA2G6 | 22 | 38148291 | A | G |
| rs2284063 | 19578365 | 8398 | PLA2G6 | umls:C1512419 | BeFree | We identified strongly associated variants in MTAP, a gene adjacent to the familial melanoma susceptibility locus CDKN2A on 9p21 (rs4636294, combined P = 3.4 x 10(-15)), as well as in PLA2G6 on 22q13.1 (rs2284063, combined P = 3.4 x 10(-8)). | 0.000271442 | 2009 | PLA2G6 | 22 | 38148291 | A | G |
| rs2284063 | 19578365 | 4507 | MTAP | umls:C1512419 | BeFree | We identified strongly associated variants in MTAP, a gene adjacent to the familial melanoma susceptibility locus CDKN2A on 9p21 (rs4636294, combined P = 3.4 x 10(-15)), as well as in PLA2G6 on 22q13.1 (rs2284063, combined P = 3.4 x 10(-8)). | 0.000271442 | 2009 | PLA2G6 | 22 | 38148291 | A | G |
| rs45476696 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21970902 | C | T,A |
| rs4636294 | 19578365 | 4507 | MTAP | umls:C1512419 | BeFree | We identified strongly associated variants in MTAP, a gene adjacent to the familial melanoma susceptibility locus CDKN2A on 9p21 (rs4636294, combined P = 3.4 x 10(-15)), as well as in PLA2G6 on 22q13.1 (rs2284063, combined P = 3.4 x 10(-8)). | 0.000271442 | 2009 | NA | 9 | 21747804 | A | G,T |
| rs4636294 | 19578365 | 1029 | CDKN2A | umls:C1512419 | BeFree | We identified strongly associated variants in MTAP, a gene adjacent to the familial melanoma susceptibility locus CDKN2A on 9p21 (rs4636294, combined P = 3.4 x 10(-15)), as well as in PLA2G6 on 22q13.1 (rs2284063, combined P = 3.4 x 10(-8)). | 0.145439591 | 2009 | NA | 9 | 21747804 | A | G,T |
| rs4636294 | 19578365 | 8398 | PLA2G6 | umls:C1512419 | BeFree | We identified strongly associated variants in MTAP, a gene adjacent to the familial melanoma susceptibility locus CDKN2A on 9p21 (rs4636294, combined P = 3.4 x 10(-15)), as well as in PLA2G6 on 22q13.1 (rs2284063, combined P = 3.4 x 10(-8)). | 0.000271442 | 2009 | NA | 9 | 21747804 | A | G,T |
| rs587780668 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21974795 | - | GGCTCCATGCTGCTCCCCGCCGCC |
| rs730881674 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21971116 | GGGTCGGGTGAGAGTGGCG | - |
| rs786204195 | NA | 1029 | CDKN2A | umls:C1512419 | CLINVAR | NA | 0.145439591 | NA | CDKN2A | 9 | 21974686 | G | T,A |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:7) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0006753 | Neoplasm of the stomach | MP:0009536 | abnormal interstitial cell of Cajal morphology | any structural anomaly in the type of cell found in the gastrointestinal tract and serving as a pacemaker that triggers gut contraction; ICCs mediate inputs from the enteric nervous system to smooth muscle cells and are thought to be the cells from which |
| HP:0100013 | Neoplasm of the breast | MP:0011205 | excessive folding of visceral yolk sac | the appearance of wrinkles or folds on the surface of the visceral yolk sac |
| HP:0100763 | Abnormality of the lymphatic system | MP:0004502 | decreased incidence of tumors by chemical induction | lower than normal frequency of tumor incidence induced by one or more chemical carcinogens or mutagens |
| HP:0001595 | Abnormality of the hair | MP:0008261 | arrest of male meiosis | cessation of the progression of the process of nuclear division that results in sperm with one half the normal chromosome number of the original cell |
| HP:0000958 | Dry skin | MP:0010678 | abnormal skin adnexa morphology | any structural anomaly of the tissue or structures associated with or embedded in the skin such as hair and hair follicles, sweat glands, sebaceous glands and claws or nails |
| HP:0002071 | Abnormality of extrapyramidal motor function | MP:0009403 | increased variability of skeletal muscle fiber size | greater range or dispersion within a distribution of skeletal muscle fiber size within a muscle compared to controls |
| HP:0002894 | Neoplasm of the pancreas | MP:0008261 | arrest of male meiosis | cessation of the progression of the process of nuclear division that results in sperm with one half the normal chromosome number of the original cell |
Mapped by homologous gene(Total Items:11) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0100763 | Abnormality of the lymphatic system | MP:0012431 | increased lymphoma incidence | greater than the expected number of neoplasms characterized by a proliferation of malignant lymphocytes in lymphoid tissue in a specific population in a given time period |
| HP:0000488 | Retinopathy | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0006753 | Neoplasm of the stomach | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0001595 | Abnormality of the hair | MP:0014127 | increased thymoma incidence | greater than the expected number of a malignant neoplasm originating from the epithelial cells of the thymus, occurring in a specific population in a given time period; thymoma is an uncommon tumor linked with myasthenia gravis and other autoimmune diseas |
| HP:0000958 | Dry skin | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001480 | Freckling | MP:0013787 | photophobia | abnormal aversion or avoidance behavior in response to light; photophobia is symptom of abnormal intolerance to visual perception of light; as a medical symptom, photophobia is not a morbid fear or phobia, but an experience of discomfort or pain to the e |
| HP:0003764 | Nevus | MP:0014171 | increased fatty acid oxidation | increased rate or incidence of the process of removal of one or more electrons from a fatty acid, with or without the concomitant removal of a proton or protons, by reaction with an electron-accepting substance, by addition of oxygen or by removal of hydr |
| HP:0002861 | Melanoma | MP:0012431 | increased lymphoma incidence | greater than the expected number of neoplasms characterized by a proliferation of malignant lymphocytes in lymphoid tissue in a specific population in a given time period |
| HP:0100013 | Neoplasm of the breast | MP:0014171 | increased fatty acid oxidation | increased rate or incidence of the process of removal of one or more electrons from a fatty acid, with or without the concomitant removal of a proton or protons, by reaction with an electron-accepting substance, by addition of oxygen or by removal of hydr |
| HP:0002071 | Abnormality of extrapyramidal motor function | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002894 | Neoplasm of the pancreas | MP:0014126 | increased mammary gland apoptosis | increase in the number of any cells of a mammary gland undergoing programmed cell death |
| Disease ID | 604 |
|---|---|
| Disease | familial melanoma |
| Case | (Waiting for update.) |